.\" Automatically generated by Pandoc 2.14.0.3 .\" .TH "VCFPRIMERS" "1" "" "vcfprimers (vcflib)" "vcfprimers (VCF transformation)" .hy .SH NAME .PP \f[B]vcfprimers\f[R] .SH SYNOPSIS .PP \f[B]vcfprimers\f[R] options .SH DESCRIPTION .PP For each VCF record, extract the flanking sequences, and write them to stdout as FASTA records suitable for alignment. .SH OPTIONS .IP .nf \f[C] options: -f, --fasta-reference FASTA reference file to use to obtain primer sequences -l, --primer-length The length of the primer sequences on each side of the variant This tool is intended for use in designing validation experiments. Primers extracted which would flank all of the alleles at multi-allelic sites. The name of the FASTA \[dq]reads\[dq] indicates the VCF record which they apply to. The form is >CHROM_POS_LEFT for the 3\[aq] primer and >CHROM_POS_RIGHT for the 5\[aq] primer, for example: >20_233255_LEFT CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA >20_233255_RIGHT ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA Type: transformation \f[R] .fi .SH EXIT VALUES .TP \f[B]0\f[R] Success .TP \f[B]not 0\f[R] Failure .SH SEE ALSO .PP vcflib(1) .SH OTHER .SH LICENSE .PP Copyright 2011-2022 (C) Erik Garrison and vcflib contributors. MIT licensed. .SH AUTHORS Erik Garrison and vcflib contributors.